Domains of the CaMV 35S promoter (Benfey et al., 1990) and enhanced... | Download Scientific Diagram
A) Sequence comparison of domain A (–90 to +1) of the 35S promoter... | Download Scientific Diagram
Part:BBa K1825004 - parts.igem.org
Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology
A) Transformation vector pMZ766E1-CAT. CaMV 35S, cauliflower mosaic... | Download Scientific Diagram
Solved Here the 203bp CaMV 35S promoter sequence that you | Chegg.com
Bidirectionalization of polar promoters in plants | Nature Biotechnology
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
Addgene: pP35S (GB0030)
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
8
Analysis of reporter proteins GUS and DsRed driven under the control of CaMV35S promoter in syncytia induced by beet cyst nematode Heterodera schachtii in Arabidopsis roots » Advancements in Life Sciences
Frontiers | Cauliflower mosaic virus (CaMV) Biology, Management, and Relevance to GM Plant Detection for Sustainable Organic Agriculture
The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters | SpringerLink
Primary structure of the 35S-luciferase gene and primers used in RT-PCR... | Download Scientific Diagram
Plants | Free Full-Text | Evaluation of Plant-Derived Promoters for Constitutive and Tissue-Specific Gene Expression in Potato
Optimised LAMP allows single copy detection of 35Sp and NOSt in transgenic maize using Bioluminescent Assay in Real Time (BART) | Scientific Reports
![PDF] Expression analysis of the 35S CaMV promoter and its derivatives in transgenic hairy root cultures of cucumber (Cucumis sativus) generated by Agrobacterium rhizogenes infection | Semantic Scholar](https://d3i71xaburhd42.cloudfront.net/358e7629cb7529cf210706439d927c9de8871820/3-Figure1-1.png "PDF] Expression analysis of the 35S CaMV promoter and its derivatives in transgenic hairy root cultures of cucumber (Cucumis sativus) generated by Agrobacterium rhizogenes infection | Semantic Scholar")
PDF] Expression analysis of the 35S CaMV promoter and its derivatives in transgenic hairy root cultures of cucumber (Cucumis sativus) generated by Agrobacterium rhizogenes infection | Semantic Scholar
The Use of 35S and Tnos Expression Elements in the Measurement of Genetically Engineered Plant Materials
The Cauliflower Mosaic Virus 35S Promoter Extends into the Transcribed Region | Journal of Virology
A 64-bp sequence containing the GAAGA motif is essential for CaMV-35S promoter methylation in gentian - ScienceDirect
Solved Here the 203bp CaMV 35 S promoter sequence that you | Chegg.com
Addgene
IJMS | Free Full-Text | A Novel Moderate Constitutive Promoter Derived from Poplar (Populus tomentosa Carrière)
