Addgene: pP35S (GB0030)
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
Strategies to mitigate transgene–promoter interactions - Gudynaite‐Savitch - 2009 - Plant Biotechnology Journal - Wiley Online Library
IJMS | Free Full-Text | Recombinase Polymerase Amplification (RPA) of CaMV-35S Promoter and nos Terminator for Rapid Detection of Genetically Modified Crops
Tuning the Transcriptional Activity of the CaMV 35S Promoter in Plants by Single-Nucleotide Changes in the TATA Box | ACS Synthetic Biology
Frontiers | Cauliflower mosaic virus (CaMV) Biology, Management, and Relevance to GM Plant Detection for Sustainable Organic Agriculture
A) Sequence comparison of domain A (–90 to +1) of the 35S promoter... | Download Scientific Diagram
Cauliflower mosaic virus - Wikipedia
Addgene: pMpGWB106
Team:IIT-Madras/Design - 2019.igem.org
35S CaMV 35S promoter, GUS β-glucuronidase, mGFP5 modified green... | Download Scientific Diagram
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
The cauliflower mosaic virus (CaMV) 35S promoter sequence alters the level and patterns of activity of adjacent tissue- and organ-specific gene promoters | SpringerLink
Solved Here the 203bp CaMV 35S promoter sequence that you | Chegg.com
Transcriptional silencing of 35S driven-transgene is differentially determined depending on promoter methylation heterogeneity at specific cytosines in both plus- and minus-sense strands | BMC Plant Biology | Full Text
11
8
The Use of 35S and Tnos Expression Elements in the Measurement of Genetically Engineered Plant Materials
Synthetic promoters: genetic control through cis engineering: Trends in Plant Science
Part:BBa K1825004 - parts.igem.org
Functional Characterization of a Strong Bi-directional Constitutive Plant Promoter Isolated from Cotton Leaf Curl Burewala Virus | PLOS ONE
Optimised LAMP allows single copy detection of 35Sp and NOSt in transgenic maize using Bioluminescent Assay in Real Time (BART) | Scientific Reports
Detection of the CaMV-35S Promoter Sequence in Maize Pollen and Seed | Semantic Scholar
