Restriction Enzyme Resource Guide
in silico biology, com - Cloning
SalI – Simplebiotech Labware
SalI
Plasmids 101: Methylation and Restriction Enzymes
Useful tool to generate unidirectional deletion vectors by utilizing the star activity of BamHI in an NcoI-BamHI-XhoI cassette | BioTechniques
Recognition sequence overlap for EcoR124I, EcoRI, and SalI. The... | Download Scientific Diagram
Digestion by NheI and SalI restriction enzymes, (A) pLexyhyg2; lane1,... | Download Scientific Diagram
Restriction Enzymes: How is DNA Manipulated?
The restriction enzyme responsible for the cleavage of following sequence is 5' - G - T - C - G - A - C - 3'3' - C - A - G - C - T - G - 5'
SalI, FastDigest™, Fermentas | VWR
Simplified plasmid cloning with a universal MCS design and bacterial in vivo assembly | BMC Biotechnology | Full Text
Restriction Enzyme - an overview | ScienceDirect Topics
Molecular cloning using polymerase chain reaction, an educational guide for cellular engineering | Journal of Biological Engineering | Full Text
SalI | NEB
QIAGEN Bioinformatics Manuals
Addgene: Prham-M.XbaI-M.EcoRI-M.SalI-p15A-aadA
Solved Start codon 5' TCCGGCGGAATTCCAAGGCCT 3' | Chegg.com
Reactions of Type II Restriction Endonucleases with 8-Base Pair Recognition Sites* - Journal of Biological Chemistry
SnapFast™ Restriction Site Functions
Solved 2. A DNA sequence is shown below, which includes a | Chegg.com
Solved This figure shows the recognition sequences and sites | Chegg.com
Scientific Library - BtrI, a novel restriction endonuclease, recognises the non-palindromic sequence 5'-CACGTC(-3/-3)-3'
14. Creation of SalI restriction site. | Download Scientific Diagram
