Repressor‐Like On‐Off Regulation of Protein Expression by the DNA‐Binding Transcription Activator‐Like Effector in T7 Promoter‐Based Cell‐Free Protein Synthesis - Sakono - 2021 - ChemBioChem - Wiley Online Library
Genes | Free Full-Text | Simple and Rapid Assembly of TALE Modules Based on the Degeneracy of the Codons and Trimer Repeats
Table S1. PCR primers and other sequences used for experiments
Standard Sequencing – 1st BASE
Table SI. Primers used in the NRAS sequencing. Primer name Primer sequence NRAS exon2 forward primer CAACAGGTTCTTGCTGGTGT NRAS e
Information | Primers-4-Yeast Your first and last stop to S. cerevisiae primers
Customized one-step preparation of sgRNA transcription templates via overlapping PCR Using short primers and its application in vitro and in vivo gene editing | Cell & Bioscience | Full Text
Introduction to DNA sequence
![PDF] Construction of an eGFP Expression Plasmid under Control of T7 Promoter and IRES Sequence for Assay of T7 RNA Polymerase Activity in Mammalian Cell Lines | Semantic Scholar](https://d3i71xaburhd42.cloudfront.net/cd83e3ed4dfaa491d209b2195f3ae8fdd08ba68e/2-Table1-1.png "PDF] Construction of an eGFP Expression Plasmid under Control of T7 Promoter and IRES Sequence for Assay of T7 RNA Polymerase Activity in Mammalian Cell Lines | Semantic Scholar")
PDF] Construction of an eGFP Expression Plasmid under Control of T7 Promoter and IRES Sequence for Assay of T7 RNA Polymerase Activity in Mammalian Cell Lines | Semantic Scholar
T7 Promoter - an overview | ScienceDirect Topics
sgRNA Synthesis Using the HiScribe™ Quick T7 High Yield RNA Synthesis Kit (NEB #E2050) | NEB
Schematic of sgRNA synthesis and three-primer PCR strategies for... | Download Scientific Diagram
Blockerette-Ligated Capture T7-Amplified RT-PCR, a New Method for Determining Flanking Sequences: Molecular Therapy
Transcriptional sequencing: A method for DNA sequencing using RNA polymerase | PNAS
Improved designs for pET expression plasmids increase protein production yield in Escherichia coli | Communications Biology
Design of synthetic external controls and sequences of NOT I probe,T7... | Download Scientific Diagram
Improved Ligation-Mediated PCR Method Coupled with T7 RNA Polymerase for Sensitive DNA Detection | Analytical Chemistry
A tailed PCR procedure for cost‐effective, two‐order multiplex sequencing of candidate genes in polyploid plants - Gholami - 2012 - Plant Biotechnology Journal - Wiley Online Library
T7 Promoter Primer
Maximizing transcription of nucleic acids with efficient T7 promoters | Communications Biology
A T7 autogene-based hybrid mRNA/DNA system for long-term shRNA expression in cytoplasm without inefficient nuclear entry | Scientific Reports
Making RNA probes with T7 transcription - OpenWetWare
Addgene: T7 promoter + terminators reporter plasmid
T3 promoter Sequencing Primer, 17-mer
